Reactivity of Human and Porcine Natural Interferon-a Producing Cells to Immunostimulatory DNA

Magnusson, M. 2003. Reactivity of human and porcine natural interferon-a producing cells to immunostimulatory DNA. Doctor’s dissertation. ISSN 1401-6257, ISBN 91-576-6389-0 The interferon-a (IFN-a) inducing capacity of various forms of immunostimulatory DNA and the identity of the IFN-a producing cells (IPC) were studied in human and porcine leukocytes. The DNA vaccine vector pcDNA3 induced production of IFN-a in porcine peripheral blood mononuclear cells (PBMC), but only if used with the transfecting agent lipofectin. Unmethylated CpG dinucleotides in the plasmid were necessary for induction of IFN-a, but pcDNA3 retained this ability after mutation of the CpG-motifs (5’AACGTT 3’) in the ampicillin resistance gene. Lipofection and presence of an unmethylated CpG were also prerequisites for the ability of the double stranded (ds) phosphodiester oligodeoxyribonucleotide (ODN) H (5’ TTTTCAATTCGAAGATGAAT 3’) to activate production of IFN-a in human and porcine PBMC. Human, but not porcine, PBMC could still produce high levels of IFN-a in response to certain single stranded (ss) ODNs, devoid of unmethylated CpG dinucleotides. This indicates that there are species differences in the recognition of immunostimulatory DNA and that eukaryotic DNA sometimes can be interferogenic. Certain CpG-containing ODNs with flanking poly-G sequences were very potent inducers of IFN-a production in the absence of lipofectin, both as phosphorothioate/ phosphodiester chimeric ODNs or as phosphodiester ODNs. Addition of poly-G sequences to the phosphodiester ODN H clearly enhanced its activity, but did not replace the need for lipofectin. The natural IFN-a producing cells (NIPC), also termed plasmacytoid dendritic cells (PDC), were the only cells among human or porcine PBMC that produced IFN-a in response to immunostimulatory DNA. The human NIPC/PDC also produce IFN-a in response to apoptotic cells in combination with autoantibodies from patients with systemic lupus erythematosus (SLE). This activation was dependent on Fcg-receptor type II (FcgRII), and the NIPC/PDC were shown to express FcgRIIa, but not the FcgRIIb/c isoforms. The FcgRIIa may also be inhibitory, because aggregated IgG that binds FcgR had a general inhibitory effect on IFN-a production induced by immunostimulatory DNA or herpes simplex virus. Elucidation of the mechanisms whereby NIPC/PDC are activated may result in more efficient vaccine adjuvants and also provide new targets aiming at inhibition of the pathologic activation of NIPC/PDC in autoimmune diseases.